Gbp5^em1Mansm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gbp5^em1Mansm
• Name: guanylate binding protein 5; endonuclease-mediated mutation 1, Si Ming Man
• MGI ID: MGI:7567379
• Synonyms: Gbp5^-
• Gene: Gbp5 Location: Chr3:142202695-142228105 bp, + strand Genetic Position: Chr3, 66.69 cM
• Alliance: Gbp5^em1Mansm page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination using guide RNAs targeting exons 2, 6, and 10 (ATTGTGGGTCTTTATCGCACAGG, CTCAAACATTCAATCTACCGCGG, and CTGCCCGGCTCGAAGCACAGAGG) resulted in a 7,268 bp deletion (GRCm39:chr3:142206457-142213724, c.140_1517del). (J:343418)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gbp5 Mutation: 39 strains or lines available

References

• Original: J:343418 Feng S, et al., Pathogen-selective killing by guanylate-binding proteins as a molecular mechanism leading to inflammasome signaling. Nat Commun. 2022 Jul 29;13(1):4395
• All: 3 reference(s)