Gbp3^em1Mansm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gbp3^em1Mansm
• Name: guanylate binding protein 3; endonuclease-mediated mutation 1, Si Ming Man
• MGI ID: MGI:7567378
• Synonyms: Gbp3^-
• Gene: Gbp3 Location: Chr3:142265787-142278970 bp, + strand Genetic Position: Chr3, 66.69 cM
• Alliance: Gbp3^em1Mansm page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination using guide RNAs targeting exons 2 and 5 (ATTGTTGGTTTATATCGTACAGG and GGCAAAATCGAGCCCCAGAGAGG) resulted in a 3,404 bp deletion (GRCm39:chr3:142267652-142271055, c.128_458del). (J:343418)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gbp3 Mutation: 34 strains or lines available

References

• Original: J:343418 Feng S, et al., Pathogen-selective killing by guanylate-binding proteins as a molecular mechanism leading to inflammasome signaling. Nat Commun. 2022 Jul 29;13(1):4395
• All: 1 reference(s)