About   Help   FAQ
Slco5a1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Slco5a1em1(IMPC)Tcp
Name: solute carrier organic anion transporter family, member 5A1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7565679
Gene: Slco5a1  Location: Chr1:12936773-13062874 bp, - strand  Genetic Position: Chr1, 3.71 cM
Alliance: Slco5a1em1(IMPC)Tcp page
IMPC: Slco5a1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AATTTAGTGGTTCTAGAGCG targeting the 5' side and ACGGCCTCTACAAGTTAGGG targeting the 3' side of a critical region (ENSMUSE00001327733). This resulted in a 740-bp deletion of Chr1 from 13013818 to 13014557 with insertion of AGGA at the deletion junction (GRCm39). Absence of this exon from mRNA is predicted to introduce a frameshift and premature stop codon. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slco5a1 Mutation:  38 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory