About   Help   FAQ
Agerem1Xulab
Endonuclease-mediated Allele Detail
Summary
Symbol: Agerem1Xulab
Name: advanced glycosylation end product-specific receptor; endonuclease-mediated mutation 1, Ding Xu
MGI ID: MGI:7565599
Synonyms: AgerAHA
Gene: Ager  Location: Chr17:34816836-34819910 bp, + strand  Genetic Position: Chr17, 18.18 cM
Alliance: Agerem1Xulab page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codons 214 (CGG), 215 (CGC) and 216 (AGA) in exon 6 were changed to alanine (GCA), histidine (CAT) and alanine (GCT) (p.R214_R216delinsAHA), respectively, using an sgRNA (targeting GGGGCCGCGTCTGGGGACTTGTG) and an ssODN template with CRISPR/Cas9 technology. The mutations in the C1 domain of the encoded peptide render it heparan sulfate (HS)-binding deficient which blocks oligomerization. (J:343334)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ager Mutation:  32 strains or lines available
References
Original:  J:343334 Li M, et al., Heparan sulfate-dependent RAGE oligomerization is indispensable for pathophysiological functions of RAGE. Elife. 2022 Feb 9;11:e71403
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory