About   Help   FAQ
Slc13a5em1(SLC13A5)Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc13a5em1(SLC13A5)Lutzy
Name: solute carrier family 13 (sodium-dependent citrate transporter), member 5; endonuclease-mediated mutation 1, Cathy Lutz
MGI ID: MGI:7565448
Gene: Slc13a5  Location: Chr11:72132815-72158048 bp, - strand  Genetic Position: Chr11, 43.95 cM
Alliance: Slc13a5em1(SLC13A5)Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Inserted expressed sequence, Null/knockout)
Mutation:    Insertion
 
Slc13a5em1(SLC13A5)Lutzy expresses 1 gene
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs (CGCCGAATCCATCGCGTGAA, GCCGAATCCATCGCGTGAAA, TGCGTGTCTGGGCAGCCTGG, AGTTGCGTGTCTGGGCAGCC) to excise and replace coding murine exon 1 with a full-length 568 amino acid WT human SLC13A5cDNA with bGH poly(A) transcription termination signal. The insertion prevents translation of the mouse Slc13a5 cDNA. Slc13a5 transcript Slc13a5-201 (ENSMUST00000021161.14) was used as reference for the exon number and guide sequences. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc13a5 Mutation:  35 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory