Polgem5Lutzy
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Polgem5Lutzy |
| Name: |
polymerase (DNA directed), gamma; endonuclease-mediated mutation 5, Cathy Lutz |
| MGI ID: |
MGI:7565444 |
| Synonyms: |
PolgR292C |
| Gene: |
Polg Location: Chr7:79095979-79116110 bp, - strand Genetic Position: Chr7, 45.04 cM, cytoband E
|
| Alliance: |
Polgem5Lutzy page
|
|
| Germline Transmission: |
Earliest citation of germline transmission:
J:366852
|
| Parent Cell Line: |
JM8A3 (ES Cell)
|
| Strain of Origin: |
C57BL/6N-Atm1Brd
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: CRISPR/cas9 genome editing used guide RNAs (CTCCCATCCACAGGCTGCGC and TTCCAGCGCAGCCTGTGGAT) to cleave DNA and a single stranded oligo donor with the silent F290F (TTC to TTT) variant and missense R292C (CGC to TGC; arginine to cysteine) variant in exon 4.The mutation is homologous to human R309C and is associated with Polg-related mitochondrial disorders.
(J:366852)
|
|
|
|
|
| Original: |
J:366852 VanPortfliet JJ, et al., Caspase-11 drives macrophage hyperinflammation in models of Polg-related mitochondrial disease. Nat Commun. 2025 May 20;16(1):4640 |
| All: |
1 reference(s) |
|