Tnfaip3^em4Irc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnfaip3^em4Irc
• Name: tumor necrosis factor, alpha-induced protein 3; endonuclease-mediated mutation 4, Inflammation Research Center
• MGI ID: MGI:7562578
• Synonyms: A20^C103R, Tnfaip3^em1Gvl
• Gene: Tnfaip3 Location: Chr10:18876658-18891158 bp, - strand Genetic Position: Chr10, 8.08 cM
• Alliance: Tnfaip3^em4Irc page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/Cas9 technology generated a TGC to CGG change resulting in a cysteine to arginine substitution at amino acid 103 (p.C103R) in the deubiquitinating OUT domain. This mutation impairs deubiquitinase function. This allele was generated by the Transgenic Core Facility (TCF) of the Inflammation Research Center (IRC) of VIB-Ugent by electroporating Cas9 (VIB Protein Service Facility) RNP complex with guide sequence 5'ACTGACAAGCTGCATGCATG 3' (iDT) and a single stranded DNA oligo with sequence 5' TTGCTTTGGGCTGCTTAACCTTGCTCCTCACAGCTCCTTCTGTCCTCAGGTGATGGAAACCGGCTCATGCATGCAGCTTGTCAGTACATGTGGGGTGTTCAGGATACTGACCTGGTCCTGAGG 3' (iDT) in C57BL/6J zygotes. This resulted in a C103R amino acid substitution (TGC)CGG; chr10-: 19008324-19008322) in exon 3 (ENSMUSE00001284116) of the Tnfaip3 gene (ENSMUSG00000019850). All base annotations are according to C57BL/6J genome assembly GRCm39. (J:343044, J:361591)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tnfaip3 Mutation: 44 strains or lines available

References

• Original: J:343044 Van Damme KFA, et al., Protein citrullination and NET formation do not contribute to the pathology of A20/TNFAIP3 mutant mice. Sci Rep. 2023 Oct 21;13(1):17992
• All: 2 reference(s)