About   Help   FAQ
Rnase4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnase4em1(IMPC)J
Name: ribonuclease, RNase A family 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7562150
Gene: Rnase4  Location: Chr14:51328534-51343608 bp, + strand  Genetic Position: Chr14, 26.37 cM, cytoband C1
Alliance: Rnase4em1(IMPC)J page
IMPC: Rnase4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCACTCTCAGAGAAAG and GTATTTGACCAGAATGTATA, which resulted in a 1570 bp deletion beginning at Chromosome 14 position 51,104,659 bp and ending after 51,106,228 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001429614 (exon 2) and 229 bp of flanking intronic sequence including the splice acceptor start site and termination site and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnase4 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory