About   Help   FAQ
Tpbglem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tpbglem1(IMPC)J
Name: trophoblast glycoprotein-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7562143
Gene: Tpbgl  Location: Chr7:99273289-99276310 bp, - strand  Genetic Position: Chr7, 54.11 cM
Alliance: Tpbglem1(IMPC)J page
IMPC: Tpbgl gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GAGACCCGAGCCTGGAGAAG and CCCCGCGCGCGGGACAGCGG, which resulted in a 1131 bp deletion beginning at Chromosome 7 position 99,625,502 bp and ending after 99,626,632 bp (GRCm38/mm10). This mutation deletes 1131 bp from ENSMUSE00001008045 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4, delete 378 amino acids, then return into frame for the last 2 amino acids before the stop codon. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tpbgl Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory