Tpbgl^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tpbgl^em1(IMPC)J
• Name: trophoblast glycoprotein-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7562143
• Gene: Tpbgl Location: Chr7:99273289-99276310 bp, - strand Genetic Position: Chr7, 54.11 cM
• Alliance: Tpbgl^em1(IMPC)J page
• IMPC: Tpbgl gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GAGACCCGAGCCTGGAGAAG and CCCCGCGCGCGGGACAGCGG, which resulted in a 1131 bp deletion beginning at Chromosome 7 position 99,625,502 bp and ending after 99,626,632 bp (GRCm38/mm10). This mutation deletes 1131 bp from ENSMUSE00001008045 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4, delete 378 amino acids, then return into frame for the last 2 amino acids before the stop codon. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tpbgl Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)