Padi6^em1Schme
Endonuclease-mediated Allele Detail

Summary

• Symbol: Padi6^em1Schme
• Name: peptidyl arginine deiminase, type VI; endonuclease-mediated mutation 1, Melina Schuh
• MGI ID: MGI:7562042
• Gene: Padi6 Location: Chr4:140454666-140469954 bp, - strand Genetic Position: Chr4, 72.26 cM, cytoband E1
• Alliance: Padi6^em1Schme page

Mutation origin

• Strain of Origin: FVB/N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination using a guide RNA (GTGCTGTTTCTCACCGGCAT(CGG)) created an 89 bp deletion in exon 3. (J:342673)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Padi6 Mutation: 32 strains or lines available

References

• Original: J:342673 Jentoft IMA, et al., Mammalian oocytes store proteins for the early embryo on cytoplasmic lattices. Cell. 2023 Oct 30
• All: 1 reference(s)