About   Help   FAQ
Rbck1em1Pcoh
Endonuclease-mediated Allele Detail
Summary
Symbol: Rbck1em1Pcoh
Name: RanBP-type and C3HC4-type zinc finger containing 1; endonuclease-mediated mutation 1, Philip Cohen
MGI ID: MGI:7562041
Synonyms: HOIL-1[C458S]
Gene: Rbck1  Location: Chr2:152158254-152174573 bp, - strand  Genetic Position: Chr2, 74.83 cM
Alliance: Rbck1em1Pcoh page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsCysteine codon 458 (TGT) in exon 12 (in ENSMUST00000028964) was changed to serine (AGC) (p.C458S) using an sgRNA (targeting AGAAGAAGGACGGCTGTGACTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation creates an E3 ligase-inactive form of the encoded peptide. (J:277157)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rbck1 Mutation:  43 strains or lines available
References
Original:  J:277157 Kelsall IR, et al., The E3 ligase HOIL-1 catalyses ester bond formation between ubiquitin and components of the Myddosome in mammalian cells. Proc Natl Acad Sci U S A. 2019 Jul 2;116(27):13293-13298
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory