About   Help   FAQ
Zc3h12aem1Aki
Endonuclease-mediated Allele Detail
Summary
Symbol: Zc3h12aem1Aki
Name: zinc finger CCCH type containing 12A; endonuclease-mediated mutation 1, Shizuo Akira
MGI ID: MGI:7562019
Synonyms: Regnase-1S513A
Gene: Zc3h12a  Location: Chr4:125012216-125021633 bp, - strand  Genetic Position: Chr4, 58.1 cM
Alliance: Zc3h12aem1Aki page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation detailsSerine codon 513 (TCT) in exon 6 was changed to alanine (GCT) (p.S513A) using sgRNAs (targeting GTGGGTGGGGGTAATGGGTA and CCTACCCATCCAGAGTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation blocks phosphorylation of the affected residue in the encoded peptide. (J:277918)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Zc3h12a Mutation:  34 strains or lines available
References
Original:  J:277918 Tanaka H, et al., Phosphorylation-dependent Regnase-1 release from endoplasmic reticulum is critical in IL-17 response. J Exp Med. 2019 Jun 3;216(6):1431-1449
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory