About   Help   FAQ
Mtv3em1Jpd
Endonuclease-mediated Allele Detail
Summary
Symbol: Mtv3em1Jpd
Name: mammary tumor virus locus 3; endonuclease-mediated mutation 1, John Driver
MGI ID: MGI:7562001
Gene: Mtv3  Location: unknown  Genetic Position: Chr11, Syntenic
Alliance: Mtv3em1Jpd page
Mutation
origin
Strain of Origin:  NOD/ShiLtJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailssgRNAs (ACATTTGCTGAGGCCTCAAC and CTCCAGAACGGAGAAGATGT) are used to excise the entire Mtv3 gene as well as the adjacent noncoding RNA segment. Transcript BC018473-204 (ENSMUST00000156293.8) is used as reference for the exon number and guide sequences for the Lnc non-coding RNA adjacent to Mtv3. (J:352184)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mtv3 Mutation:  1 strain or line available
References
Original:  J:352184 Ye C, et al., Deletion of Vbeta3(+)CD4(+) T cells by endogenous mouse mammary tumor virus 3 prevents type 1 diabetes induction by autoreactive CD8(+) T cells. Proc Natl Acad Sci U S A. 2023 Dec 5;120(49):e2312039120
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory