Mtv3^em1Jpd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mtv3^em1Jpd
• Name: mammary tumor virus locus 3; endonuclease-mediated mutation 1, John Driver
• MGI ID: MGI:7562001
• Gene: Mtv3 Location: unknown Genetic Position: Chr11, Syntenic
• Alliance: Mtv3^em1Jpd page

Mutation origin

• Strain of Origin: NOD/ShiLtJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: sgRNAs (ACATTTGCTGAGGCCTCAAC and CTCCAGAACGGAGAAGATGT) are used to excise the entire Mtv3 gene as well as the adjacent noncoding RNA segment. Transcript BC018473-204 (ENSMUST00000156293.8) is used as reference for the exon number and guide sequences for the Lnc non-coding RNA adjacent to Mtv3. (J:352184)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mtv3 Mutation: 1 strain or line available

References

• Original: J:352184 Ye C, et al., Deletion of Vbeta3(+)CD4(+) T cells by endogenous mouse mammary tumor virus 3 prevents type 1 diabetes induction by autoreactive CD8(+) T cells. Proc Natl Acad Sci U S A. 2023 Dec 5;120(49):e2312039120
• All: 1 reference(s)