Pla2g4b^em1Btlr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pla2g4b^em1Btlr
• Name: phospholipase A2, group IVB (cytosolic); endonuclease-mediated mutation 1, Bruce Beutler
• MGI ID: MGI:7561496
• Synonyms: Pla2g4b^-
• Gene: Pla2g4b Location: Chr2:119863914-119873514 bp, + strand Genetic Position: Chr2, 60.09 cM
• Alliance: Pla2g4b^em1Btlr page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: A knockout allele was created using an sgRNA (targeting GGCACTGGCCAACCTCTATGAGG) with CRISPR/Cas9 technology. (J:240936)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pla2g4b Mutation: 42 strains or lines available

References

• Original: J:240936 Choi JH, et al., IgD class switching is initiated by microbiota and limited to mucosa-associated lymphoid tissue in mice. Proc Natl Acad Sci U S A. 2017 Feb 14;114(7):E1196-E1204
• All: 1 reference(s)