Gt(ROSA)26Sor^{em1(CAG-GFP*,-mCherry*)Jwtt}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(CAG-GFP*,-mCherry*)Jwtt}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Jonathan Watts
• MGI ID: MGI:7560666
• Synonyms: TLR-MCV1
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(CAG-GFP*,-mCherry*)Jwtt} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: A guide RNA [ACTCCAGTCTTTCTAGAAGA] is selected to introduce a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), disrupted green fluorescent protein (GFP) sequence, a T2A peptide sequence, a frame-shifted mCherry (red fluorescent) sequence and a PolyA signal, into the Gt(ROSA)26Sor locus. Gt(ROSA)26Sor transcript Gt(ROSA)26Sor-205 (ENSMUST00000242415.1) was used as reference for the exon number and the guide sequences. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1062 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 2 reference(s)