About   Help   FAQ
Gt(ROSA)26Sorem1(CAG-GFP*,-mCherry*)Jwtt
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem1(CAG-GFP*,-mCherry*)Jwtt
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Jonathan Watts
MGI ID: MGI:7560666
Synonyms: TLR-MCV1
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem1(CAG-GFP*,-mCherry*)Jwtt page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailsA guide RNA [ACTCCAGTCTTTCTAGAAGA] is selected to introduce a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), disrupted green fluorescent protein (GFP) sequence, a T2A peptide sequence, a frame-shifted mCherry (red fluorescent) sequence and a PolyA signal, into the Gt(ROSA)26Sor locus. Gt(ROSA)26Sor transcript Gt(ROSA)26Sor-205 (ENSMUST00000242415.1) was used as reference for the exon number and the guide sequences. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1084 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory