Mlklem1Najaf
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mlklem1Najaf |
| Name: |
mixed lineage kinase domain-like; endonuclease-mediated mutation 1, Ayaz Najafov |
| MGI ID: |
MGI:7550372 |
| Synonyms: |
MLKLS345A;S347A, SA2 |
| Gene: |
Mlkl Location: Chr8:112038429-112064809 bp, - strand Genetic Position: Chr8, 57.98 cM, cytoband D3
|
| Alliance: |
Mlklem1Najaf page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: CRISPR/cas9 endonuclease-mediated genome editing is used to insert serine to alanine amino acid substitutions at codons 345 and 347 (S345A TCC to GCC, S347A AGC to GCC) in exon 8. Mlkl transcript Mlkl-201 (ENSMUSG00000012519) was used as reference for the exon number and guide sequences. crRNA (AAACACAGAAUUCCAUCAGCGUUUUAGAGCUAUGCUGUUUUG), cas9 endonuclease and a single strain oligo template (tttcaacgtctgcatctaacacatctgtctgtctagCTTGCAGGATTTGAGTTAAGCAAAACACAGAATGCCAT CGCCCGAACAGCAAAGAGCACTAAAGCAGAGAGATCCAGTTCAACG) are used. The substitutions block RIPK3 phosphorylation events blocking necroptotic cell death.
(J:101977)
|
|
|
|
|
| Original: |
J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017; |
| All: |
2 reference(s) |
|