About   Help   FAQ
Tmeff1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmeff1em1(IMPC)J
Name: transmembrane protein with EGF-like and two follistatin-like domains 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7548809
Gene: Tmeff1  Location: Chr4:48585174-48663131 bp, + strand  Genetic Position: Chr4, 26.15 cM, cytoband B2
Alliance: Tmeff1em1(IMPC)J page
IMPC: Tmeff1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACTAGGCATCTCATTCAC and AATGTCAGATTACAAAACGG, which resulted in a 317 bp deletion beginning at Chromosome 4 position 48,604,417 bp and ending after 48,604,733 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000178348 (exon 2) and 207 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early stop 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tmeff1 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory