Esrra^em1Vgi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Esrra^em1Vgi
• Name: estrogen related receptor, alpha; endonuclease-mediated mutation 1, Vincent Giguere
• MGI ID: MGI:7547433
• Synonyms: ERRalpha^3SA
• Gene: Esrra Location: Chr19:6888345-6899182 bp, - strand Genetic Position: Chr19, 5.08 cM
• Alliance: Esrra^em1Vgi page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codons 19 (AGT), 22 (AGT) and 26 (TCC) in exon 2 were changed to alanine (GCT, GCT and GCC) (p.S19A, p.S22A, p.S26A) using an sgRNA (targeting CCTGACAGTCCAAAGGGTTCCTC) and an ssODN template. The mutations prevent the phosphorylation of the three residues in the encoded peptide. (J:342225)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Esrra Mutation: 30 strains or lines available

References

• Original: J:342225 Xia H, et al., Insulin action and resistance are dependent on a GSK3beta-FBXW7-ERRalpha transcriptional axis. Nat Commun. 2022 Apr 19;13(1):2105
• All: 3 reference(s)