About   Help   FAQ
Myrfem1Zhif
Endonuclease-mediated Allele Detail
Summary
Symbol: Myrfem1Zhif
Name: myelin regulatory factor; endonuclease-mediated mutation 1, Zhigang Fan
MGI ID: MGI:7547374
Synonyms: MYRFmut
Gene: Myrf  Location: Chr19:10185636-10218112 bp, - strand  Genetic Position: Chr19, 6.54 cM
Alliance: Myrfem1Zhif page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Intragenic deletion
 
Mutation detailsA single nucleotide deletion (GRCm39:chr19:10200883Gdel, c.789Cdel) was engineered in exon 6 (in ENSMUST00000189897) using an sgRNA (targeting GGCAAGGCTGTGACAGTCCCAGG) and an ssODN template with CRISPR/Cas9 technology, leading to a frameshift and premature stop codon (p.N264Tfs*8). The mutation is the equivalent of the human c.789Cdel, p.S264Afs*8 mutation associated with nanophthalmos. (J:302837)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Myrf Mutation:  102 strains or lines available
References
Original:  J:302837 Yu X, et al., Nanophthalmos-Associated MYRF Gene Mutation Causes Ciliary Zonule Defects in Mice. Invest Ophthalmol Vis Sci. 2021 Mar 1;62(3):1
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory