Arl14ep^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arl14ep^em1(IMPC)J
• Name: ADP-ribosylation factor-like 14 effector protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7545684
• Gene: Arl14ep Location: Chr2:106792874-106804742 bp, - strand Genetic Position: Chr2, 55.97 cM, cytoband E3
• Alliance: Arl14ep^em1(IMPC)J page
• IMPC: Arl14ep gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGTTAAACCTGAAAGCCA and AAACTGCATTCCAGACTCGG, which resulted in a 475 bp deletion beginning at Chromosome 2 position 106,966,958 bp and ending after 106,967,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208985 (exon 3) and 347 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 141 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arl14ep Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)