Arl14epem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Arl14epem1(IMPC)J |
| Name: |
ADP-ribosylation factor-like 14 effector protein; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7545684 |
| Gene: |
Arl14ep Location: Chr2:106792874-106804742 bp, - strand Genetic Position: Chr2, 55.97 cM, cytoband E3
|
| Alliance: |
Arl14epem1(IMPC)J page
|
| IMPC: |
Arl14ep gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGTTAAACCTGAAAGCCA and AAACTGCATTCCAGACTCGG, which resulted in a 475 bp deletion beginning at Chromosome 2 position 106,966,958 bp and ending after 106,967,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208985 (exon 3) and 347 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 141 and early truncation 7 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|