About   Help   FAQ
Nhlrc1em1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Nhlrc1em1Tcp
Name: NHL repeat containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7545165
Synonyms: MalinFLAG
Gene: Nhlrc1  Location: Chr13:47166033-47168326 bp, - strand  Genetic Position: Chr13, 24.5 cM
Alliance: Nhlrc1em1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by microinjecting Cas9 mRNA with a guide RNA with the spacer sequence AGCGGAGCAGCGGGAGCAAT and a single-stranded oligonucleotide repair template. This resulted in the insertion of a FLAG tag at the N-terminus. (J:334420)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nhlrc1 Mutation:  16 strains or lines available
References
Original:  J:334420 Mitra S, et al., Laforin targets malin to glycogen in Lafora progressive myoclonus epilepsy. Dis Model Mech. 2023 Jan 1;16(1)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory