About   Help   FAQ
Prr16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Prr16em1(IMPC)J
Name: proline rich 16; endonuclease-mediated mutation, Jackson
MGI ID: MGI:7543712
Gene: Prr16  Location: Chr18:51250970-51437713 bp, + strand  Genetic Position: Chr18, 27.97 cM
Alliance: Prr16em1(IMPC)J page
IMPC: Prr16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGCTGTAGATCAGAGGTCA and TGGTAGTGGTGGATTTCCTC, which resulted in a 708 bp deletion beginning at Chromosome 18 position 51,302,635 bp and ending after 51,303,342 bp (GRCm38/mm10). This mutation deletes 708 bp from ENSMUSE00000707416 (exon 2) and because of the 1 bp G insertion is predicted to cause a change of amino acid sequence after residue 61 and early truncation 12 amino acids later. There is a 1 bp insertion (G) at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Prr16 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory