Apcdd1^em1Jlp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Apcdd1^em1Jlp
• Name: adenomatosis polyposis coli down-regulated 1; endonuclease-mediated mutation 1, Jose de la Pompa
• MGI ID: MGI:7543634
• Synonyms: Apcdd1^V150I
• Gene: Apcdd1 Location: Chr18:63055398-63086886 bp, + strand Genetic Position: Chr18, 35.95 cM
• Alliance: Apcdd1^em1Jlp page

Mutation origin

• Strain of Origin: C57BL/6-Mib1^em1Jlp

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Valine codon 150 (GTC) in exon 4 was changed to isoleucine (ATT) (p.V150I) using a crRNA (targeting CCTCTGTGTGGCAGATGACT) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of human SNPs rs3748415 found in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1^em1Jlp allele and created at the same time as the Asxl3^em1Jlp allele. (J:338889)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Apcdd1 Mutation: 49 strains or lines available

References

• Original: J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
• All: 1 reference(s)