About   Help   FAQ
Apcdd1em1Jlp
Endonuclease-mediated Allele Detail
Summary
Symbol: Apcdd1em1Jlp
Name: adenomatosis polyposis coli down-regulated 1; endonuclease-mediated mutation 1, Jose de la Pompa
MGI ID: MGI:7543634
Synonyms: Apcdd1V150I
Gene: Apcdd1  Location: Chr18:63055398-63086886 bp, + strand  Genetic Position: Chr18, 35.95 cM
Alliance: Apcdd1em1Jlp page
Mutation
origin
Strain of Origin:  C57BL/6-Mib1em1Jlp
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsValine codon 150 (GTC) in exon 4 was changed to isoleucine (ATT) (p.V150I) using a crRNA (targeting CCTCTGTGTGGCAGATGACT) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of human SNPs rs3748415 found in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em1Jlp allele and created at the same time as the Asxl3em1Jlp allele. (J:338889)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Apcdd1 Mutation:  50 strains or lines available
References
Original:  J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory