About   Help   FAQ
Mib1em2Jlp
Endonuclease-mediated Allele Detail
Summary
Symbol: Mib1em2Jlp
Name: MIB E3 ubiquitin protein ligase 1; endonuclease-mediated mutation 2, Jose de la Pompa
MGI ID: MGI:7543448
Synonyms: Mib1V943F
Gene: Mib1  Location: Chr18:10725548-10818704 bp, + strand  Genetic Position: Chr18, 5.35 cM
Alliance: Mib1em2Jlp page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsValine codon 943 (GTT) in exon 20 was changed to phenylalanine (TTT) (p.V943F) using an sgRNA (targeting CTGCACATCTGCGTTAACAT) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the same human mutation (c.2827G>T) found in some left ventricular noncompaction (LVNC) patients. (J:338889)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mib1 Mutation:  55 strains or lines available
References
Original:  J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory