Tg^em1Arvn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tg^em1Arvn
• Name: thyroglobulin; endonuclease-mediated mutation 1, Peter Arvan
• MGI ID: MGI:7543436
• Synonyms: Tg^rdw
• Gene: Tg Location: Chr15:66542606-66722570 bp, + strand Genetic Position: Chr15, 29.3 cM, cytoband D3-E
• Alliance: Tg^em1Arvn page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: CRISPR/cas9 mediated recombination using guide RNA (GGTGGTCAGCTGACCATTGA) and donor vector (ACCATGGAGATGGAAGGCAGTGGTGGTCAGCTGACCATTGATCGCAGCATCCTGGCTGCAGTTGGCAACTTCATCGTAGTC) induced a G to C mutations resulting in a G to R substitution at position 2298 in exon 40. (J:341698)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tg Mutation: 148 strains or lines available

References

• Original: J:341698 Zhang X, et al., Maintaining the thyroid gland in mutant thyroglobulin-induced hypothyroidism requires thyroid cell proliferation that must continue in adulthood. J Biol Chem. 2022 May 23;298(7):102066
• All: 1 reference(s)