About   Help   FAQ
Fastkd3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fastkd3em1(IMPC)J
Name: FAST kinase domains 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7543098
Gene: Fastkd3  Location: Chr13:68730353-68740457 bp, + strand  Genetic Position: Chr13, 35.55 cM
Alliance: Fastkd3em1(IMPC)J page
IMPC: Fastkd3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATGGCGTTCATCACCCTG and TTTTTCCTTCAGCGGCTGCA, which resulted in a 1430 bp deletion beginning at Chromosome 13 position 68,583,568 bp and ending after 68,584,997 bp (GRCm38/mm10). This mutation deletes 1430 bp from ENSMUSE00000641296 (exon 2) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fastkd3 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory