About   Help   FAQ
Il2rgem1Slc
Endonuclease-mediated Allele Detail
Summary
Symbol: Il2rgem1Slc
Name: interleukin 2 receptor, gamma chain; endonuclease-mediated mutation 1, Japan SLC
MGI ID: MGI:7541496
Synonyms: Il2rg-
Gene: Il2rg  Location: ChrX:100307991-100311861 bp, - strand  Genetic Position: ChrX, 43.9 cM
Alliance: Il2rgem1Slc page
Mutation
origin
Strain of Origin:  C.Cg-Foxn1nu/Slc
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExons 3 and 8 were targeted with sgRNAs (targeting CCAGGAGTGCAGTCACTATTTGT and CCTTTTTCTACCTATGATTCAAC) using CRISPR/Cas9 technology, resulting in a deletion. The allele was targeted in Foxn1nu mice. (J:341230)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Il2rg Mutation:  132 strains or lines available
References
Original:  J:341230 Takagi Y, et al., Characterization of novel, severely immunodeficient Prkdc(Deltaex57/Deltaex57) mice. Biochem Biophys Res Commun. 2023 Oct 20;678:193-199
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory