About   Help   FAQ
Dhx9em1Atsug
Endonuclease-mediated Allele Detail
Summary
Symbol: Dhx9em1Atsug
Name: DExH-box helicase 9; endonuclease-mediated mutation 1, Atsushi Sugie
MGI ID: MGI:7541265
Synonyms: Dhx9G416R
Gene: Dhx9  Location: Chr1:153331504-153363406 bp, - strand  Genetic Position: Chr1, 65.37 cM
Alliance: Dhx9em1Atsug page
Mutation
origin
Strain of Origin:  (C57BL/6 x C3H)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsGlycine codon 416 (GGT) in exon 12 was changed to arginine (CGG) (p.G416R) using an sgRNA (targeting GTGATTATCCGAGGGGCTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the human p.G414R mutation found in a patient with a neurodevelopmental disorder. (J:339227)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Dhx9 Mutation:  77 strains or lines available
References
Original:  J:339227 Yamada M, et al., Heterozygous loss-of-function DHX9 variants are associated with neurodevelopmental disorders: Human genetic and experimental evidences. Eur J Med Genet. 2023 Aug;66(8):104804
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory