About   Help   FAQ
Slc37a4em2Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc37a4em2Lutzy
Name: solute carrier family 37 (glucose-6-phosphate transporter), member 4; endonuclease-mediated mutation 2, Cathy Lutz
MGI ID: MGI:7541200
Synonyms: Slc37a4 Exon 3 cKO
Gene: Slc37a4  Location: Chr9:44308243-44314263 bp, + strand  Genetic Position: Chr9, 24.84 cM, cytoband B
Alliance: Slc37a4em2Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing uses guide RNAs (GGGATATTTTAGGAGCCTGA, ATATTTTAGGAGCCTGAGGG, ATTCCTTCGCCTACATCCAG, TTGCCACTGGATGTAGGCGA) to excise and replace murine exon 3 with a loxP-flanked wild type exon 3 cassette. Slc37a4 transcript Slc37a4-201 (ENSMUST00000165839.3) was used as reference for the exon number and guide sequences. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc37a4 Mutation:  17 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory