About   Help   FAQ
Pgm5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pgm5em1(IMPC)J
Name: phosphoglucomutase 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7539831
Gene: Pgm5  Location: Chr19:24660380-24839219 bp, - strand  Genetic Position: Chr19, 19.78 cM
Alliance: Pgm5em1(IMPC)J page
IMPC: Pgm5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATAGCCTCTCAGATGCACA and AAGTAGTTATTAGGTGGCAG, which resulted in a 538 bp deletion beginning at Chromosome 19 position 24,834,581 bp and ending after 24,835,118 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001204964 (exon 2) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 75 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pgm5 Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory