About   Help   FAQ
Lacc1em1Flv
Endonuclease-mediated Allele Detail
Summary
Symbol: Lacc1em1Flv
Name: laccase domain containing 1; endonuclease-mediated mutation 1, Richard A Flavell
MGI ID: MGI:7539559
Synonyms: Lacc1-
Gene: Lacc1  Location: Chr14:77261640-77274344 bp, - strand  Genetic Position: Chr14, 40.63 cM
Alliance: Lacc1em1Flv page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExons 3 and 7 were targeted with sgRNAs (targeting AAACTGCCATGAGACCTTACTGG and GTTAAGGCCATCGCGGACATGGG) using CRISPR/Cas9 technology, resulting in a deletion. (J:339910)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lacc1 Mutation:  31 strains or lines available
References
Original:  J:339910 Wei Z, et al., LACC1 bridges NOS2 and polyamine metabolism in inflammatory macrophages. Nature. 2022 Sep;609(7926):348-353
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory