About   Help   FAQ
Pacs1em5(PACS1*R201W)Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Pacs1em5(PACS1*R201W)Lutzy
Name: phosphofurin acidic cluster sorting protein 1; endonuclease-mediated mutation 5, Cathy Lutz
MGI ID: MGI:7539214
Synonyms: LSL-huPacs1-exon4 R201W
Gene: Pacs1  Location: Chr19:5183714-5323138 bp, - strand  Genetic Position: Chr19, 4.25 cM
Alliance: Pacs1em5(PACS1*R201W)Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Humanized sequence)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsGuide RNAs (CCAGAGGGCCTGGTACTGCA,AGAAAGAAAGAAATGCCAGA,GGGCTATAAAACCTTAGCTG, and GGCTATAAAACCTTAGCTGT) are selected to excise and replace murine exon 4 with a human exon 4 containing the R201W (CGG to TGG, arginine to tryptophan, c.601) variant. A loxP-flanked STOP cassette, which contains a splice acceptor and 3x SV40 polyadenylation sequence is inserted into intron 3/4. Mouse Pcs1 transcript Pac1-201 (ENSMUST00000025786.9) and human PACS1-201 (ENST00000320580.9) were used as reference for the exon number and guide sequences. The mutation is orthologous to the human R203W mutation. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pacs1 Mutation:  48 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory