Pik3r1em1Ekd
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Pik3r1em1Ekd |
| Name: |
phosphoinositide-3-kinase regulatory subunit 1; endonuclease-mediated mutation 1, Elissa K Deenick |
| MGI ID: |
MGI:7539172 |
| Synonyms: |
Pik3r1E11SpD, Pik3r1 LOF |
| Gene: |
Pik3r1 Location: Chr13:101817269-101904725 bp, - strand Genetic Position: Chr13, 53.92 cM
|
| Alliance: |
Pik3r1em1Ekd page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: The exon/intron 11 splice donor site was targeted with an sgRNA (targeting GGAGTACACCCGTACTTCCCAGG) and an ssODN template using CRISPR/Cas9 technology, resulting in a G-to-A substitution that changes the G-GT splice site to G-AT, which leads to skipping of in-frame exon 11, which encodes part of the inter-SH2 domain. This mutation is the equivalent of a human splice donor mutation associated with PASLI (p110delta-activating mutations causing senescent T cells, lymphadenopathy, and immunodeficiency) like disease or activated PI3Kdelta syndrome 2.
(J:340835)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Pik3r1 Mutation: |
53 strains or lines available
|
|
| Original: |
J:340835 Nguyen T, et al., Human PIK3R1 mutations disrupt lymphocyte differentiation to cause activated PI3Kdelta syndrome 2. J Exp Med. 2023 Jun 5;220(6) |
| All: |
1 reference(s) |
|