n-TFgaa6^em1Afi
Endonuclease-mediated Allele Detail

Summary

• Symbol: n-TFgaa6^em1Afi
• Name: nuclear encoded tRNA pheylalanine 6 (anticodon GAA); endonuclease-mediated mutation 1, Aleksandra Filipovska
• MGI ID: MGI:7538945
• Synonyms: Phe 1-5^-
• Gene: n-TFgaa6 Location: Chr19:11979600-11979672 bp, + strand Genetic Position: Chr19, Syntenic
• Alliance: n-TFgaa6^em1Afi page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The gene was targeted with an sgRNA (targeting GCGTTAGACTGAAGATCTAA) using CRISPR/Cas9 technology, resulting in a 37 bp deletion (TAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCTAAA). (J:335324)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any n-TFgaa6 Mutation: 0 strains or lines available

References

• Original: J:335324 Hughes LA, et al., Copy number variation in tRNA isodecoder genes impairs mammalian development and balanced translation. Nat Commun. 2023 Apr 18;14(1):2210
• All: 1 reference(s)