About   Help   FAQ
n-TFgaa4em1Afi
Endonuclease-mediated Allele Detail
Summary
Symbol: n-TFgaa4em1Afi
Name: nuclear encoded tRNA pheylalanine 4 (anticodon GAA); endonuclease-mediated mutation 1, Aleksandra Filipovska
MGI ID: MGI:7538943
Synonyms: Phe 1-3-
Gene: n-TFgaa4  Location: Chr13:21345575-21345647 bp, + strand  Genetic Position: Chr13, Syntenic
Alliance: n-TFgaa4em1Afi page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe gene was targeted with an sgRNA (targeting GCGTTAGACTGAAGATCTAA) using CRISPR/Cas9 technology, resulting in a 6 bp deletion (TCTAAA). (J:335324)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any n-TFgaa4 Mutation:  0 strains or lines available
References
Original:  J:335324 Hughes LA, et al., Copy number variation in tRNA isodecoder genes impairs mammalian development and balanced translation. Nat Commun. 2023 Apr 18;14(1):2210
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory