About   Help   FAQ
Klrk1em1Ccg
Endonuclease-mediated Allele Detail
Summary
Symbol: Klrk1em1Ccg
Name: killer cell lectin-like receptor subfamily K, member 1; endonuclease-mediated mutation 1, Christopher C Goodnow
MGI ID: MGI:7537041
Synonyms: Klrk1KO
Gene: Klrk1  Location: Chr6:129587286-129600827 bp, - strand  Genetic Position: Chr6, 63.44 cM
Alliance: Klrk1em1Ccg page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExons 4 and 8 was targeted with two sgRNAs (targeting TCACAACGTGGTATAGTCCTAGG and GTTGAAGCCTATCCAAACTAGGG) using CRISPR/Cas9 technology, leading to a 4,781 bp deletion encompassing exons 4-8. (J:340910)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Klrk1 Mutation:  24 strains or lines available
References
Original:  J:340910 Masle-Farquhar E, et al., STAT3 gain-of-function mutations connect leukemia with autoimmune disease by pathological NKG2D(hi) CD8(+) T cell dysregulation and accumulation. Immunity. 2022 Dec 13;55(12):2386-2404.e8
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory