Cx3cr1em1Ccg
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cx3cr1em1Ccg |
| Name: |
C-X3-C motif chemokine receptor 1; endonuclease-mediated mutation 1, Christopher C Goodnow |
| MGI ID: |
MGI:7537040 |
| Synonyms: |
Cx3cr1KO |
| Gene: |
Cx3cr1 Location: Chr9:119877749-119897362 bp, - strand Genetic Position: Chr9, 71.37 cM
|
| Alliance: |
Cx3cr1em1Ccg page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: Exon 2 was targeted with an sgRNA (targeting TACGCCCTCGTCTTCACGTTCGG) using CRISPR/Cas9 technology, leading to a 1 bp deletion (GRCm39:chr9:g.119881268delA) that causes a frameshift and a premature stop codon (p.F45Sfs*28).
(J:340910)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Cx3cr1 Mutation: |
50 strains or lines available
|
|
| Original: |
J:340910 Masle-Farquhar E, et al., STAT3 gain-of-function mutations connect leukemia with autoimmune disease by pathological NKG2D(hi) CD8(+) T cell dysregulation and accumulation. Immunity. 2022 Dec 13;55(12):2386-2404.e8 |
| All: |
1 reference(s) |
|