About   Help   FAQ
Chchd10em2Dpn
Endonuclease-mediated Allele Detail
Summary
Symbol: Chchd10em2Dpn
Name: coiled-coil-helix-coiled-coil-helix domain containing 10; endonuclease-mediated mutation 2, Derek P Narendra
MGI ID: MGI:7532644
Synonyms: C10S59L
Gene: Chchd10  Location: Chr10:75768964-75773581 bp, + strand  Genetic Position: Chr10, 38.62 cM
Alliance: Chchd10em2Dpn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsSerine codon 55 (TCA) in exon 3 was changed to leucine (CTG) (p.S55L) using an sgRNA (targeting TAGCCGTGGGCTCAGCTGTA) and an ssODN template using CRISPR/Cas9 technology. The mutation is the equivalent of the human p.S59L mutation found in a family with ALS, frontotemporal dementia (FTD) and myopathy. (J:295994)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Chchd10 Mutation:  19 strains or lines available
References
Original:  J:295994 Liu YT, et al., Loss of CHCHD2 and CHCHD10 activates OMA1 peptidase to disrupt mitochondrial cristae phenocopying patient mutations. Hum Mol Genet. 2020 Jun 3;29(9):1547-1567
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory