Chchd10^em1Dpn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chchd10^em1Dpn
• Name: coiled-coil-helix-coiled-coil-helix domain containing 10; endonuclease-mediated mutation 1, Derek P Narendra
• MGI ID: MGI:7532640
• Synonyms: C10^-, C10 KO
• Gene: Chchd10 Location: Chr10:75768964-75773581 bp, + strand Genetic Position: Chr10, 38.62 cM
• Alliance: Chchd10^em1Dpn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 2 and 4 were targeted with sgRNAs (targeting CCCACCGCAGTCATGCCTC and GAGCGACCTAACCCTGTGTG) using CRISPR/Cas9 technology, resulting in a deletion from the end of exon 2 to most of exon 4 (GRCm39:chr10:75771802-75773251). (J:295994)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Chchd10 Mutation: 19 strains or lines available

References

• Original: J:295994 Liu YT, et al., Loss of CHCHD2 and CHCHD10 activates OMA1 peptidase to disrupt mitochondrial cristae phenocopying patient mutations. Hum Mol Genet. 2020 Jun 3;29(9):1547-1567
• All: 3 reference(s)