About   Help   FAQ
Sall4em1Bird
Endonuclease-mediated Allele Detail
Summary
Symbol: Sall4em1Bird
Name: spalt like transcription factor 4; endonuclease-mediated mutation 1, Adrian Bird
MGI ID: MGI:7532617
Synonyms: Sall4 ZFC4mut
Gene: Sall4  Location: Chr2:168590252-168609121 bp, - strand  Genetic Position: Chr2, 88.99 cM
Alliance: Sall4em1Bird page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsThreonine codon 919 (ACG) in exon 3 was changed to aspartic acid (GAT) (p.T919D) and asparagine codon 922 (AAC) in exon 3 to alanine (GCC) (p.N922A) using an sgRNA (targeting CGTGTGTAACATATGCGGGC) and an ssODN template with CRISPR/Cas9 technology. The mutations affect the AT-binding zinc finger in C2H2 zinc finger cluster 4 (ZFC4) of the encoded peptide. (J:303180)
Expression
In Mice Carrying this Mutation: 6 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Sall4 Mutation:  145 strains or lines available
Notes
E14Ju09 ES cell line
References
Original:  J:303180 Pantier R, et al., SALL4 controls cell fate in response to DNA base composition. Mol Cell. 2021 Feb 18;81(4):845-858.e8
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory