About   Help   FAQ
Rptorem2Rjsh
Endonuclease-mediated Allele Detail
Summary
Symbol: Rptorem2Rjsh
Name: regulatory associated protein of MTOR, complex 1; endonuclease-mediated mutation 2, Reuben J Shaw
MGI ID: MGI:7529770
Synonyms: RaptorA
Gene: Rptor  Location: Chr11:119493731-119790402 bp, + strand  Genetic Position: Chr11, 83.96 cM, cytoband E2
Alliance: Rptorem2Rjsh page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsSerine codon 792 (TCC) in exon 20 was changed to alanine (GCG) (p.S792A) using an sgRNA (targeting CGGCGAGGACTCACCTATGAGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue in the encoded peptide to a phosphoblocker. (J:303713)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rptor Mutation:  114 strains or lines available
References
Original:  J:303713 Van Nostrand JL, et al., AMPK regulation of Raptor and TSC2 mediate metformin effects on transcriptional control of anabolism and inflammation. Genes Dev. 2020 Oct 1;34(19-20):1330-1344
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory