About   Help   FAQ
Ntrk2em1Tac
Endonuclease-mediated Allele Detail
Summary
Symbol: Ntrk2em1Tac
Name: neurotrophic tyrosine kinase, receptor, type 2; endonuclease-mediated mutation 1, Taconic
MGI ID: MGI:7529665
Synonyms: Ntrk2em6006(Y433F)Tac, TRKB.Y433F
Gene: Ntrk2  Location: Chr13:58954383-59281784 bp, + strand  Genetic Position: Chr13, 31.2 cM
Alliance: Ntrk2em1Tac page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsTyrosine codon 433 (TAT) in exon 12 was changed to phenylalanine (TTC) (NM_001025074:c.1298_1299delATinsTC, p.Y433F) using an sgRNA (targeting TCCTCAGGTCTATGCCGTGGTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation, in the CARC domain of the encoded peptide, affects BDNF-induced translocation of NTRK2 to lipid-raft regions on the neuronal surface. (J:303948)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ntrk2 Mutation:  63 strains or lines available
References
Original:  J:303948 Casarotto PC, et al., Antidepressant drugs act by directly binding to TRKB neurotrophin receptors. Cell. 2021 Mar 4;184(5):1299-1313.e19
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory