Slc25a37^em1Hfzh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc25a37^em1Hfzh
• Name: solute carrier family 25, member 37; endonuclease-mediated mutation 1, Huafeng Zhang
• MGI ID: MGI:7529632
• Synonyms: Mfrn1^-
• Gene: Slc25a37 Location: Chr14:69479297-69522561 bp, - strand Genetic Position: Chr14, 36.03 cM, cytoband D1
• Alliance: Slc25a37^em1Hfzh page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• CRISPR/Cas9 technology using sgRNA GAACGTGATGATGATGGGTG generated a knock-out allele. (J:321213)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc25a37 Mutation: 9 strains or lines available

References

• Original: J:321213 Zhang T, et al., ENO1 suppresses cancer cell ferroptosis by degrading the mRNA of iron regulatory protein 1. Nat Cancer. 2022 Jan;3(1):75-89
• All: 1 reference(s)