Mecp2^em3Gfng
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mecp2^em3Gfng
• Name: methyl CpG binding protein 2; endonuclease-mediated mutation 3, Guoping Feng
• MGI ID: MGI:7526786
• Synonyms: Mecp2^c.882_886A>, Mecp2^em1Guof
• Gene: Mecp2 Location: ChrX:73070198-73129296 bp, - strand Genetic Position: ChrX, 37.63 cM
• Alliance: Mecp2^em3Gfng page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: Five nucleotides in the coding region were replaced with an A (ENSMUST00000100750:c.881_885GGTCTdelinsA) using an sgRNA (AGUCUCAUGCACAGACCGUA) with CRISPR/Cas9 technology, leading to a frameshift and premature stop codon (p.R294Qfs*26). (J:334099)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mecp2 Mutation: 46 strains or lines available

References

• Original: J:334099 Wilde JJ, et al., Efficient embryonic homozygous gene conversion via RAD51-enhanced interhomolog repair. Cell. 2021 Jun 10;184(12):3267-3280.e18
• All: 1 reference(s)