Slc25a33^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc25a33^em1(IMPC)J
• Name: solute carrier family 25, member 33; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7526370
• Gene: Slc25a33 Location: Chr4:149828493-149858734 bp, - strand Genetic Position: Chr4, 80.15 cM, cytoband E1
• Alliance: Slc25a33^em1(IMPC)J page
• IMPC: Slc25a33 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGCACCCCAGATACCTTG and GCATGAACATCCAGGTGCAG, which resulted in a 501 bp deletion beginning at Chromosome 4 position 149,753,556 bp and ending after 149,754,056 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000184185 (exon 4) and 400 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc25a33 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)