About   Help   FAQ
Del(11Gsdma3-Gsdma)1Cnlr
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(11Gsdma3-Gsdma)1Cnlr
Name: deletion, Chr 11, Christopher N LaRock 1
MGI ID: MGI:7522806
Gene: Del(11Gsdma3-Gsdma)1Cnlr  Location: unknown  Genetic Position: Chr11, Syntenic
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intergenic deletion
  Del(11Gsdma3-Gsdma)1Cnlr involves 3 genes/genome features (Gsdma3, Gsdma2, Gsdma) View all
 
Mutation detailsCRISPR/Cas9 technology using the 5 gRNA TTTATGCATCCATCAAGGCT which cut 54 bp upstream of Gsdma3 exon 1 and the 3 gRNA TCGGAGTCATTCATCGGCCA which cut 156 bp downstream of Gsdma1 exon 12, deleted a region of approximately 52 kb that eliminates the coding sequence of all three genes Gsdma, Gsdma2, and Gsdma3 and includes no overlapping genes on either DNA strand. Sequencing confirmed knock-out of all three genes. (J:339428)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(11Gsdma3-Gsdma)1Cnlr Mutation:  0 strains or lines available
References
Original:  J:339428 LaRock DL, et al., Group A Streptococcus induces GSDMA-dependent pyroptosis in keratinocytes. Nature. 2022 May;605(7910):527-531
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory