Hr^em1Utr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hr^em1Utr
• Name: Hr, lysine demethylase and nuclear receptor corepressor; endonuclease-mediated mutation 1, University of Tsukuba Laboratory Animal Resource Center
• MGI ID: MGI:7522713
• Gene: Hr Location: Chr14:70789652-70810988 bp, + strand Genetic Position: Chr14, 36.32 cM
• Alliance: Hr^em1Utr page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-targeting using an sgRNA targeting AGCCCCTGTGAACGGCATTGTGG produced a 5 bp deletion (GRCm39:chr14:70793891-70793895delCGGCA) at exon 3, which causes a frameshift and premature stop codon (p.G22Cfs*56). (J:259614)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Hr Mutation: 86 strains or lines available

References

• Original: J:259614 Hoshino Y, et al., Simple generation of hairless mice for in vivo imaging. Exp Anim. 2017 Oct 30;66(4):437-445
• All: 1 reference(s)