About   Help   FAQ
Hrem1Utr
Endonuclease-mediated Allele Detail
Summary
Symbol: Hrem1Utr
Name: Hr, lysine demethylase and nuclear receptor corepressor; endonuclease-mediated mutation 1, University of Tsukuba Laboratory Animal Resource Center
MGI ID: MGI:7522713
Gene: Hr  Location: Chr14:70789652-70810988 bp, + strand  Genetic Position: Chr14, 36.32 cM
Alliance: Hrem1Utr page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-targeting using an sgRNA targeting AGCCCCTGTGAACGGCATTGTGG produced a 5 bp deletion (GRCm39:chr14:70793891-70793895delCGGCA) at exon 3, which causes a frameshift and premature stop codon (p.G22Cfs*56). (J:259614)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Hr Mutation:  86 strains or lines available
References
Original:  J:259614 Hoshino Y, et al., Simple generation of hairless mice for in vivo imaging. Exp Anim. 2017 Oct 30;66(4):437-445
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory