About   Help   FAQ
Wdfy4em1Kmm
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdfy4em1Kmm
Name: WD repeat and FYVE domain containing 4; endonuclease-mediated mutation 1, Kenneth M Murphy
MGI ID: MGI:7522226
Gene: Wdfy4  Location: Chr14:32681504-32907465 bp, - strand  Genetic Position: Chr14, 19.44 cM
Alliance: Wdfy4em1Kmm page
Mutation
origin
Strain of Origin:  NOD/ShiLtJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing uses sgRNAs (CATGTAGCCTTGAGGTACAT and GTCCCCTTTCCTCATAGACT) to delete exon 4. (J:339363)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Wdfy4 Mutation:  144 strains or lines available
References
Original:  J:339363 Ferris ST, et al., WDFY4 deficiency in NOD mice ameliorates autoimmune diabetes and insulitis. Proc Natl Acad Sci U S A. 2023 Mar 28;120(13):e2219956120
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory