Tbr1^em1Boro
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbr1^em1Boro
• Name: T-box brain transcription factor 1; endonuclease-mediated mutation 1, Brian Oroak
• MGI ID: MGI:7521939
• Synonyms: Tbr1^A136fs
• Gene: Tbr1 Location: Chr2:61633274-61644458 bp, + strand Genetic Position: Chr2, 35.56 cM
• Alliance: Tbr1^em1Boro page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A 1 nt deletion at cDNA position 402 (c.402del) was created by targeting exon 1 with an sgRNA (targeting GTACCCCAGCCAGCACGGAC) and an ssODN template using CRISPR/Cas9 technology, resulting in a frameshift and premature stop codon (p.A136Pfs*80). Tbr1 transcript Tbr1-201 (ENSMUST00000048934.15) is used as reference for exon number and guide sequence. There is no detectable TBR1 protein expression from this allele. This frameshift mutation was identified in a patient with autism. (J:339271)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tbr1 Mutation: 36 strains or lines available

References

• Original: J:339271 Co M, et al., Shared and Distinct Functional Effects of Patient-Specific Tbr1 Mutations on Cortical Development. J Neurosci. 2022 Sep 14;42(37):7166-7181
• All: 1 reference(s)