Tbr1em1Boro
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tbr1em1Boro |
| Name: |
T-box brain transcription factor 1; endonuclease-mediated mutation 1, Brian Oroak |
| MGI ID: |
MGI:7521939 |
| Synonyms: |
Tbr1A136fs |
| Gene: |
Tbr1 Location: Chr2:61633274-61644458 bp, + strand Genetic Position: Chr2, 35.56 cM
|
| Alliance: |
Tbr1em1Boro page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence, Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: A 1 nt deletion at cDNA position 402 (c.402del) was created by targeting exon 1 with an sgRNA (targeting GTACCCCAGCCAGCACGGAC) and an ssODN template using CRISPR/Cas9 technology, resulting in a frameshift and premature stop codon (p.A136Pfs*80). Tbr1 transcript Tbr1-201 (ENSMUST00000048934.15) is used as reference for exon number and guide sequence. There is no detectable TBR1 protein expression from this allele. This frameshift mutation was identified in a patient with autism.
(J:339271)
|
|
|
|
|
| Original: |
J:339271 Co M, et al., Shared and Distinct Functional Effects of Patient-Specific Tbr1 Mutations on Cortical Development. J Neurosci. 2022 Sep 14;42(37):7166-7181 |
| All: |
1 reference(s) |
|