About   Help   FAQ
Dynll2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dynll2em1(IMPC)J
Name: dynein light chain LC8-type 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7520901
Gene: Dynll2  Location: Chr11:87870351-87878359 bp, - strand  Genetic Position: Chr11, 52.35 cM, cytoband C
Alliance: Dynll2em1(IMPC)J page
IMPC: Dynll2 gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATGCTGTTAGTGCCACCGGT and TGGGAGCTATAAGGTTAGCG, which resulted in a 4626 bp deletion beginning at Chromosome 11 position 87,979,468 bp and ending after 87,984,093 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000105250 and ENSMUSE00000674840 (exons 2 and 3) and 2441 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dynll2 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory